Apriliapatni, Ni Made Deliabudi (2025) DESAIN PRIMER DAN OPTIMASI METODE NESTED POLYMERASE CHAIN REACTION SEBAGAI DETEKSI SPESIFIK BAKTERI Escherichia coli. Diploma thesis, Poltekkes Kemenkes Denpasar Jurusan Teknologi Laboratorium Medis 2024.
|
Text (Skripsi 2024)
HALAMAN DEPAN.pdf Download (454kB) | Preview |
|
|
Text (Skripsi 2024)
BAB I PENDAHULUAN.pdf Download (200kB) | Preview |
|
|
Text (Skripsi 2024)
BAB II TINJAUAN PUSTAKA.pdf Download (285kB) | Preview |
|
|
Text (Skripsi 2024)
BAB III KERANGKA KONSEP.pdf Download (198kB) | Preview |
|
|
Text (Skripsi 2024)
BAB IV METODE PENELITIAN.pdf Download (278kB) | Preview |
|
|
Text (Skripsi 2024)
BAB V HASIL DAN PEMBAHASAN.pdf Download (960kB) | Preview |
|
|
Text (Skripsi 2024)
BAB VI PENUTUP.pdf Download (206kB) | Preview |
|
|
Text (Skripsi 2024)
DAFTAR PUSTAKA.pdf Download (211kB) | Preview |
|
|
Text (Skripsi 2024)
LAMPIRAN-LAMPIRAN.pdf Download (1MB) | Preview |
Abstract
PRIMER DESIGN AND OPTIMIZATION OF NESTED POLYMERASE CHAIN REACTION METHOD AS SPECIFIC DETECTION OF Escherichia coli BACTERIA ABSTRACT Escherichia coli is a bacterium that caused diarrhea, poisoning, meningitis, myositis, and primary bloodstream infections. The conventional methods which are the commonly used detection for E. coli has various disadvantages. Nested Polymerase Chain Reaction is a molecular examination with high specificity that requires complement primers to the target sequence. This study aimed to obtain the primer design and the optimal Nested PCR reaction as E. coli detection. The research conducted quantitative descriptive by in silico methods in primer design and in vitro method in optimization of Nested PCR. The results obtained two pairs of primers, F1 5’TCTCCGTGAAGCTGGTTTCC3’ and R1 5’GCGACCAATCAGATCCACCA3’ produced 509 bp amplicon, F2 5’ATCGGTGAAATACGCAGGCT3’ and R2 5’TCGTCACCTTGAATGGCAGG3’ produced 305 bp amplicon. The optimal reaction obtained for the first stage of Nested PCR carried out in 20 cycles, 300 mM primer concentration, and annealing temperature 55 °C. The second stage Nested PCR carried out in 35 cycles, 300 mM primer concentration, and annealing temperature 55 °C. The results of examination for suspected E. coli colonies obtained positive results in 7 out of 10 samples. It can be concluded that the primer with optimal Nested PCR reaction produced in the study can be used as detection of E. coli bacteria. Keywords: Primer Design; Optimization; Nested Polymerase Chain Reaction; Escherichia coli DESAIN PRIMER DAN OPTIMASI METODE NESTED POLYMERASE CHAIN REACTION SEBAGAI DETEKSI SPESIFIK BAKTERI Escherichia coli ABSTRAK Escherichia coli merupakan bakteri penyebab diare, keracunan, meningitis, myositis, hingga infeksi aliran darah primer. Pemeriksaan yang umum dilakukan sebagai deteksi infeksi E. coli yaitu metode konvensional memiliki berbagai kelemahan. Nested Polymerase Chain Reaction merupakan metode pemeriksaan berbasis molekuler dengan spesifisitas tinggi yang memerlukan primer komplemen terhadap sekuen target. Penelitian ini bertujuan untuk mendapatkan desain primer serta reaksi Nested PCR yang optimal sebagai deteksi spesifik bakteri E. coli. Jenis penelitian yaitu kuantitatif deskriptif yang terdiri dari metode in silico dalam desain primer dan in vitro dalam optimasi metode Nested PCR. Hasil penelitian didapatkan dua pasang primer, yaitu primer pertama F1 5’TCTCCGTGAAGCTGGTTTCC3’ dan R1 5’GCGACCAATCAGATCCACCA3’ menghasilkan produk 509 bp, primer kedua F2 5’ATCGGTGAAATACGCAGGCT3’ dan R2 5’TCGTCACCTTGAATGGCAGG3’ dengan ukuran produk 305 bp. Reaksi optimal yang didapat yaitu untuk Nested PCR tahap pertama dilakukan dalam 20 siklus, konsentrasi primer 300 mM, dan suhu annealing 55℃, serta untuk Nested PCR tahap kedua dilakukan dalam 35 siklus, konsentrasi primer 300 mM, dan suhu annealing 55℃. Hasil pemeriksaan koloni terduga E. coli didapatkan hasil positif pada 7 dari 10 sampel. Dengan demikian dapat disimpulkan bahwa desain primer dan reaksi Nested PCR yang dihasilkan dalam penelitian dapat digunakan sebagai deteksi bakteri E. coli. Kata kunci: Desain Primer; Optimasi; Nested Polymerase Chain Reaction; Escherichia coli
| Item Type: | Thesis (Diploma) |
|---|---|
| Uncontrolled Keywords: | Optimization; Nested Polymerase Chain Reaction; Escherichia coli, Desain Primer; Optimasi; Nested Polymerase Chain Reaction; Escherichia coli |
| Subjects: | Q Science > Q Science (General) Q Science > QR Microbiology R Medicine > RB Pathology |
| Divisions: | Jurusan Analis Kesehatan |
| Depositing User: | STRTLM DENPASAR |
| Date Deposited: | 15 Jan 2025 00:27 |
| Last Modified: | 15 Jan 2025 00:27 |
| URI: | http://repository.poltekkes-denpasar.ac.id/id/eprint/14354 |
Actions (login required)
![]() |
View Item |

