Dewi, Putu Surya Kencana Talia (2024) DESAIN PRIMER DAN OPTIMASI METODE POLYMERASE CHAIN REACTION UNTUK DETEKSI SPESIFIK BAKTERI Salmonella typhi. Diploma thesis, Poltekkes Kemenkes Denpasar Jurusan Teknologi Laboratorium Medis 2024.
|
Text (Skripsi 2024)
Bab I Pendahuluan.pdf Download (408kB) |
|
|
Text (Skripsi 2024)
Bab II Tinjauan Pustaka.pdf Download (489kB) |
|
|
Text (Skripsi 2024)
Bab III Kerangka Konsep.pdf Download (732kB) |
|
|
Text (Skripsi 2024)
Bab IV Metode Penelitian.pdf Download (1MB) |
|
|
Text (Skripsi 2024)
Bab V Hasil dan Pembahasan.pdf Download (323kB) |
|
|
Text (Skripsi 2024)
Bab VI Simpulan dan Saran.pdf Download (333kB) |
|
|
Text (Skripsi 2024)
Daftar Pustaka.pdf Download (333kB) |
|
|
Text (Skripsi 2024)
Lampiran-lampiran.pdf Download (1MB) |
|
|
Text (Skripsi 2024)
Halaman Depan.pdf Download (1MB) |
Abstract
PRIMER DESIGN AND OPTIMIZATION OF POLYMERASE CHAIN REACTION METHOD TO DETECT SPESIFIC BACTERIA Salmonella typhi ABSTRACT Background: WHO estimates 11-20 million global cases of typhoid fever per year, with a mortality rate of 128,000-161,000 per year. This disease is caused by Salmonella typhi and spreads through contaminated food or water. The development of PCR methods aims for faster and more specific diagnosis, allowing for the detection of Salmonella typhi from various types of samples. This study aims to obtain specific primer designs, optimize PCR reaction conditions to detect Salmonella typhi using PCR methods, and analyze the qualitative and quantitative results of Salmonella typhi identification. This research is of a descriptive qualitative type. The study resulted in a pair of primers: forward 5’ GCGTGGTGAAAGATGCCTTC3’ and reverse 5’ ATGTCGATGGCCACGGAAAT3’, designed using in silico bioinformatics methods. Optimization results showed that the optimal PCR reaction was achieved at a primer concentration of 500 mM, an annealing temperature of 55℃, and 35 cycles. PCR identification results for suspected Salmonella typhi bacteria showed amplification results that were not identical to the positive control, thus indicating a negative result. Keywords: Primer Design; Optimazation; Polymerase Chain Reaction; Salmonella typhi DESAIN PRIMER DAN OPTIMASI METODE POLYMERASE CHAIN REACTION UNTUK DETEKSI SPESIFIK BAKTERI Salmonella typhi ABSTRAK Latar belakang WHO memperkirakan 11-20 juta kasus demam tifoid global per tahun, dengan tingkat kematian 128.000-161.000 per tahun. Penyakit ini disebabkan oleh Salmonella typhi, menyebar melalui makanan atau air terkontaminasi. Pengembangan metode PCR untuk diagnosis lebih cepat dan spesifik seperti metode PCR, untuk deteksi Salmonella typhi dari berbagai jenis sampel. Penelitian ini bertujuan untuk mendapatkan desain primer yang spesifik, reaksi optimasi PCR yang optimal untuk mendeteksi bakteri Salmonella typhi dengan metode PCR serta menganalisis hasil identifikasi bakteri Salmonella typhi secara kualitatif dan kuantitatif. Jenis penelitian pada penelitian ini yaitu deskriptif kualitatif. Hasil penelitian didapatkan sepasang primer yaitu forward 5’ GCGTGGTGAAAGATGCCTTC3’ dan reverse 5’ ATGTCGATGGCCACGGAAAT3’ dengan metode in silico berbasis bioinformatika. Hasil optimasi menunjukan reaksi PCR yang optimal didapatkan pada konsentrasi primer 500mM, suhu annealing 55℃, dan 35 siklus. Hasil identifikasi PCR pada bakteri terduga Salmonella typhi menunjukkan hasil amplikasi yang tidak identik dengan control positif sehingga dinyatakan negatif. Kata kunci: Desain Primer; Optimasi Polymerase Chain Reaction;Salmonella typhi
| Item Type: | Thesis (Diploma) |
|---|---|
| Uncontrolled Keywords: | Primer Design; Optimazation; Polymerase Chain Reaction; Salmonella typhi Desain Primer; Optimasi Polymerase Chain Reaction; Salmonella typhi |
| Subjects: | Q Science > Q Science (General) Q Science > QD Chemistry Q Science > QR Microbiology Q Science > QR Microbiology > QR180 Immunology |
| Divisions: | Jurusan Analis Kesehatan |
| Depositing User: | STRTLM DENPASAR |
| Date Deposited: | 10 Jan 2025 04:32 |
| Last Modified: | 10 Jan 2025 04:32 |
| URI: | http://repository.poltekkes-denpasar.ac.id/id/eprint/14172 |
Actions (login required)
![]() |
View Item |

